Events
PublicationsA možda ipak ...
Page 4 of 12
Page 4 of 12 • 
1, 2, 3, 4, 5 ... 10, 11, 12
Re: A možda ipak ...
by danni1 2/4/2020, 13:18
Pa naravno da ima.Legendovich wrote:brasna ima u ducanima..!!!! ne kao standardno,ali ga ima..!!!
Sad se vidi da ga netko kupuje. Prije su police bile krcate i izgledalo je kao da nitko brašno ne kupuje. Sad tu i tamo fali koji paket.
danni1- Posts : 5159
2014-04-16
Re: A možda ipak ...
by T. 2/4/2020, 13:36
Kod nas ima svega naravno...danni1 wrote:Pa naravno da ima.Legendovich wrote:brasna ima u ducanima..!!!! ne kao standardno,ali ga ima..!!!
Sad se vidi da ga netko kupuje. Prije su police bile krcate i izgledalo je kao da nitko brašno ne kupuje. Sad tu i tamo fali koji paket.
Ali moguće on govori o pripizdini njemačkoj...
Brašno im dolazi na par-nepar, a kvasca nemaju nikako...
T.- Posts : 17560
2014-04-14
Age : 83
Re: A možda ipak ...
by Guest 2/4/2020, 13:37
ebi ga..vodje zivi 80 miljuna dusa...kod vas u vasoj Pustari,malo ih ima koji i mogu kupiti brasno.malo vecu kolicinu...kvasca ima ponovno..T. wrote:Kod nas ima svega naravno...danni1 wrote:Pa naravno da ima.Legendovich wrote:brasna ima u ducanima..!!!! ne kao standardno,ali ga ima..!!!
Sad se vidi da ga netko kupuje. Prije su police bile krcate i izgledalo je kao da nitko brašno ne kupuje. Sad tu i tamo fali koji paket.
Ali moguće on govori o pripizdini njemačkoj...
Brašno im dolazi na par-nepar, a kvasca nemaju nikako...
Guest- Guest
Re: A možda ipak ...
by Guest 5/4/2020, 22:38
Carl Zimmer: Should scientists self-censor their H5N1 research?
By dallasnews Administrator
3:04 AM on Dec 31, 2011
Here is one of the scariest things you’ll ever read:
atggagagaataaaagaattaagagatctaatgtcacagtcccgcactcgcgagatactaacaaaaaccactgtggaccatatggccataatcaagaaat
These are the first 100 units of a gene in an influenza virus. This particular flu virus belongs to a strain called H5N1. It breeds and spreads among birds, but on rare occasions it can infect people. And when it does, it is frighteningly fatal, with a mortality rate of about 60 percent.
The only consolation for such deaths is that there are not more of them. The virus has proved unable to spread from person to person since it first emerged 14 years ago.
Since then, scientists have put great effort into understanding the virus, worried that it might evolve into a pandemic that could cause a worldwide disaster. But now some new experiments on bird flu have plunged the scientific community into a debate about the risks of learning — and sharing — the virus’ secrets.
Researchers have produced a variant of H5N1 that reportedly can spread from one mammal to another. So far they’ve documented its spread in ferrets; no one knows what it would do if it got out of the lab. But fearing that the information could be used to create a biological weapon, a federal advisory board has taken the unprecedented step of calling for some of the results to be withheld from any published papers about the work.
A number of scientists agree with the board, saying that publishing too much information about this research could make it possible for terrorists to weaponize the flu. Others are warning that withholding data won’t make us safe, and that the best defense against bioterror — both human and natural — is transparency.
Steffen Mueller, a virologist at Stony Brook University in New York, says, “I much prefer dealing with the devil I know over the devil I don’t.”
Transparency is one of the most cherished values in modern science; it allows scientists to build on one another’s research — and check each other’s work. But over the past decade, scientists have gotten worried that this kind of research could help someone trying to build biological weapons.
The cost of sequencing and synthesizing DNA has crashed year after year, making biological engineering easier for people to do. All of these swift changes in biology led to the formation of the National Science Advisory Board for Biosecurity in 2004, made up of some of the country’s leading experts on microbiology and biological warfare.
Part of their charge was to review potentially dangerous research — often called “dual use” research for its two-sided potential to be used for good or evil ends. For the first seven years of its existence, the board approached its mission with a very light touch. But these new H5N1 studies have roused the board to action.
What few details we know of the unpublished research show an H5N1 virus that could spread through the air from one ferret to the other. If unleashed — and if proved capable of spreading from human to human with the same high mortality rate — it could make the deadly 1918 pandemic look like a pesky cold.
The research is funded by the National Institutes of Health, which was alarmed by the results. The studies were passed to the advisory board, which hashed out the matter for weeks. On Dec. 20, the panel urged that “conclusions of the manuscripts be published, but without experimental details and mutation data that would enable replication of the experiments.”
The board has no legal, binding authority. But it’s clear that the authors, the journals and the NIH are taking the board’s unprecedented vote seriously and are working on a way to follow its recommendations.
A number of scientists outside the board have applauded it for ensuring that bioterrorists don’t get their hands on information they could use. They’re concerned that publishing the new studies in full would offer a useful starting point for someone who’s trying to turn H5N1 into a biological weapon. They could add more mutations, using the same methods of passing viruses from one animal to another until they hit the virological jackpot.
There are a lot of reasons to consider this scenario unlikely: The experiments weren’t simple; they were carried out in some of the world’s most sophisticated virology labs.
But let’s assume for the moment that the risks are big enough to worry about. Is holding back information the best way to eliminate them?
Eckard Wimmer, a Stony Brook University virologist, doesn’t think so, since the gist of the experiments has already escaped. If some villain has enough money, he or she can just run a similar experiment.
For Wimmer, who built polioviruses nine years ago, this controversy causes an intense case of déjà vu. His virus creations caused an uproar. There was even a movement in Congress to condemn the research. But Wimmer had a good reason for synthesizing viruses from scratch. He’s helped turn synthetic viruses into promising vaccines against diseases such as influenza.
We may fear the risks that come with scientific progress, but Wimmer’s work reveals the dangers of fear itself. When the next bird flu comes — and it will come — it may be Wimmer’s Frankenstein viruses that save us.
https://www.dallasnews.com/opinion/commentary/2011/12/31/carl-zimmer-should-scientists-self-censor-their-h5n1-research/
By dallasnews Administrator
3:04 AM on Dec 31, 2011
Here is one of the scariest things you’ll ever read:
atggagagaataaaagaattaagagatctaatgtcacagtcccgcactcgcgagatactaacaaaaaccactgtggaccatatggccataatcaagaaat
These are the first 100 units of a gene in an influenza virus. This particular flu virus belongs to a strain called H5N1. It breeds and spreads among birds, but on rare occasions it can infect people. And when it does, it is frighteningly fatal, with a mortality rate of about 60 percent.
The only consolation for such deaths is that there are not more of them. The virus has proved unable to spread from person to person since it first emerged 14 years ago.
Since then, scientists have put great effort into understanding the virus, worried that it might evolve into a pandemic that could cause a worldwide disaster. But now some new experiments on bird flu have plunged the scientific community into a debate about the risks of learning — and sharing — the virus’ secrets.
Researchers have produced a variant of H5N1 that reportedly can spread from one mammal to another. So far they’ve documented its spread in ferrets; no one knows what it would do if it got out of the lab. But fearing that the information could be used to create a biological weapon, a federal advisory board has taken the unprecedented step of calling for some of the results to be withheld from any published papers about the work.
A number of scientists agree with the board, saying that publishing too much information about this research could make it possible for terrorists to weaponize the flu. Others are warning that withholding data won’t make us safe, and that the best defense against bioterror — both human and natural — is transparency.
Steffen Mueller, a virologist at Stony Brook University in New York, says, “I much prefer dealing with the devil I know over the devil I don’t.”
Transparency is one of the most cherished values in modern science; it allows scientists to build on one another’s research — and check each other’s work. But over the past decade, scientists have gotten worried that this kind of research could help someone trying to build biological weapons.
The cost of sequencing and synthesizing DNA has crashed year after year, making biological engineering easier for people to do. All of these swift changes in biology led to the formation of the National Science Advisory Board for Biosecurity in 2004, made up of some of the country’s leading experts on microbiology and biological warfare.
Part of their charge was to review potentially dangerous research — often called “dual use” research for its two-sided potential to be used for good or evil ends. For the first seven years of its existence, the board approached its mission with a very light touch. But these new H5N1 studies have roused the board to action.
What few details we know of the unpublished research show an H5N1 virus that could spread through the air from one ferret to the other. If unleashed — and if proved capable of spreading from human to human with the same high mortality rate — it could make the deadly 1918 pandemic look like a pesky cold.
The research is funded by the National Institutes of Health, which was alarmed by the results. The studies were passed to the advisory board, which hashed out the matter for weeks. On Dec. 20, the panel urged that “conclusions of the manuscripts be published, but without experimental details and mutation data that would enable replication of the experiments.”
The board has no legal, binding authority. But it’s clear that the authors, the journals and the NIH are taking the board’s unprecedented vote seriously and are working on a way to follow its recommendations.
A number of scientists outside the board have applauded it for ensuring that bioterrorists don’t get their hands on information they could use. They’re concerned that publishing the new studies in full would offer a useful starting point for someone who’s trying to turn H5N1 into a biological weapon. They could add more mutations, using the same methods of passing viruses from one animal to another until they hit the virological jackpot.
There are a lot of reasons to consider this scenario unlikely: The experiments weren’t simple; they were carried out in some of the world’s most sophisticated virology labs.
But let’s assume for the moment that the risks are big enough to worry about. Is holding back information the best way to eliminate them?
Eckard Wimmer, a Stony Brook University virologist, doesn’t think so, since the gist of the experiments has already escaped. If some villain has enough money, he or she can just run a similar experiment.
For Wimmer, who built polioviruses nine years ago, this controversy causes an intense case of déjà vu. His virus creations caused an uproar. There was even a movement in Congress to condemn the research. But Wimmer had a good reason for synthesizing viruses from scratch. He’s helped turn synthetic viruses into promising vaccines against diseases such as influenza.
We may fear the risks that come with scientific progress, but Wimmer’s work reveals the dangers of fear itself. When the next bird flu comes — and it will come — it may be Wimmer’s Frankenstein viruses that save us.
https://www.dallasnews.com/opinion/commentary/2011/12/31/carl-zimmer-should-scientists-self-censor-their-h5n1-research/
Guest- Guest
Re: A možda ipak ...
by Guest 5/4/2020, 23:50
Threatened pandemics and laboratory escapes: Self-fulfilling prophecies
By Martin Furmanski, March 31, 2014
The public health danger from the escape, from laboratories, of viruses capable of causing pandemics has become the subject of considerable, well-merited discussion, spurred by “gain of function” experiments. The ostensible goal of these experiments— in which researchers manipulate already-dangerous pathogens to create or increase communicability among humans—is to develop tools to monitor the natural emergence of pandemic strains. Opponents, however, warn that the risk of laboratory escape of these high-consequence pathogens far outweighs any potential advance. These arguments appear in a variety of recent research papers, including Rethinking Biosafety in Research on Potential Pandemic Pathogens; The Human Fatality and Economic Burden of a Man-made Influenza Pandemic: A Risk Assessment; Containing the Accidental Laboratory Escape of Potential Pandemic Influenza Viruses; and Response to Letter by the European Society for Virology on "Gain-of-Function" Influenza Research.
The risk of a manmade pandemic sparked by a laboratory escape is not hypothetical: One occurred in 1977, and it occurred because of concern that a natural pandemic was imminent. Many other laboratory escapes of high-consequence pathogens have occurred, resulting in transmission beyond laboratory personnel.
Ironically, these laboratories were working with pathogens to prevent the very outbreaks they ultimately caused. For that reason, the tragic consequences have been called “self-fulfilling prophecies.”
Rethinking Biosafety in Research on Potential Pandemic Pathogens
ABSTRACT
If accidentally released, mammalian-transmissible influenza A/H5N1 viruses could pose a greater threat to public health than possibly any other infectious agent currently under study in laboratories, because of such viruses’ likely combination of transmissibility and virulence to humans. We advocate explicit risk-benefit assessments before work on such pathogens is permitted or funded, improvement of biosafety practices and enforcement, and harmonization of criteria for permitting such experiments across government agencies, as well as internationally. Such potential pandemic pathogens, as they have been called, jeopardize not only laboratory workers and their contacts, but also the wider population, who should be involved in assessments of when such risks are acceptable in the service of scientific knowledge that may itself bear major public health benefits.
Go to:
COMMENTARY
Mammalian-transmissible, highly virulent influenza viruses pose a threat to human health and life much greater than that posed by most pathogens classified as biosafety level 3 and 4 (BSL-3 and BSL-4) agents. Therefore, any activity that creates even a small risk of releasing such viruses deserves exceptional scrutiny. The magnitude of public health risk from an accidental release of a pathogen depends on how many people could become infected, times the risk of severe or fatal outcome per case, and is modified by the availability of countermeasures that could stop the spread of such a pathogen or reduce the severity of infection. Most biosafety level 4 (BSL-4) pathogens—including certain arenaviruses (e.g., Lassa viruses), filoviruses (e.g., Ebola virus and Marburg virus), and Hendra viruses (e.g., Hendra virus and Nipah virus)—are zoonotic agents that often cause severe or fatal disease in infected humans. However, an accidental release of these viruses would likely have limited global impact because their person-to-person transmission is inefficient in most settings. In addition, they exist “in the wild,” so an accidental release would not be the only source for risk of transmission to humans. While influenza A/H5N1 virus exists in the wild, mammalian-transmissible strains do not exist outside the laboratory as far as we are aware. If a mammalian-transmissible variant maintains a case fatality rate within even an order of magnitude of the 60% case fatality rate of its wild-type parent (1) and if it is as transmissible between humans as other common influenza viruses that infect humans, an accidental release would pose a grave, and completely novel, threat to human health. Once a novel strain of influenza virus establishes significant transmission in humans, stopping its spread would require massive global use of vaccines, a scenario that has never been accomplished in practice and could not be done in time for H5N1 because sufficient stockpiles do not exist worldwide and trust in vaccines is declining globally (2). Therefore, a highly transmissible, highly virulent virus like the modified H5N1 strains that have been created has the potential to infect billions and potentially kill a large fraction of those.
Of course, an accidental release of such a pathogen is not certain to cause such destruction; we do not yet know whether such viruses are indeed human-to-human transmissible, though this was the rationale for their creation, and we do not know whether they remain as virulent as their wild-type parent strains. And even if both of these were true, a single accidental infection is not guaranteed to spread widely. Nonetheless, it would be capable of doing so. Even if a release of such a pathogen were contained before it spread widely, such an accident would severely threaten the credibility of life scientists, research institutions, including universities, and public health agencies.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3484391/
The Human Fatality Burden of Gain of Function Flu Research:
http://www.pathobiologics.org/btac/ref/TheHumanFatalityBurdenofGainofFunctionFluResearch.pdf
Historical perspective--Emergence of influenza A (H1N1) viruses.
https://www.ncbi.nlm.nih.gov/pubmed/19564632
By Martin Furmanski, March 31, 2014
The public health danger from the escape, from laboratories, of viruses capable of causing pandemics has become the subject of considerable, well-merited discussion, spurred by “gain of function” experiments. The ostensible goal of these experiments— in which researchers manipulate already-dangerous pathogens to create or increase communicability among humans—is to develop tools to monitor the natural emergence of pandemic strains. Opponents, however, warn that the risk of laboratory escape of these high-consequence pathogens far outweighs any potential advance. These arguments appear in a variety of recent research papers, including Rethinking Biosafety in Research on Potential Pandemic Pathogens; The Human Fatality and Economic Burden of a Man-made Influenza Pandemic: A Risk Assessment; Containing the Accidental Laboratory Escape of Potential Pandemic Influenza Viruses; and Response to Letter by the European Society for Virology on "Gain-of-Function" Influenza Research.
The risk of a manmade pandemic sparked by a laboratory escape is not hypothetical: One occurred in 1977, and it occurred because of concern that a natural pandemic was imminent. Many other laboratory escapes of high-consequence pathogens have occurred, resulting in transmission beyond laboratory personnel.
Ironically, these laboratories were working with pathogens to prevent the very outbreaks they ultimately caused. For that reason, the tragic consequences have been called “self-fulfilling prophecies.”
Rethinking Biosafety in Research on Potential Pandemic Pathogens
ABSTRACT
If accidentally released, mammalian-transmissible influenza A/H5N1 viruses could pose a greater threat to public health than possibly any other infectious agent currently under study in laboratories, because of such viruses’ likely combination of transmissibility and virulence to humans. We advocate explicit risk-benefit assessments before work on such pathogens is permitted or funded, improvement of biosafety practices and enforcement, and harmonization of criteria for permitting such experiments across government agencies, as well as internationally. Such potential pandemic pathogens, as they have been called, jeopardize not only laboratory workers and their contacts, but also the wider population, who should be involved in assessments of when such risks are acceptable in the service of scientific knowledge that may itself bear major public health benefits.
Go to:
COMMENTARY
Mammalian-transmissible, highly virulent influenza viruses pose a threat to human health and life much greater than that posed by most pathogens classified as biosafety level 3 and 4 (BSL-3 and BSL-4) agents. Therefore, any activity that creates even a small risk of releasing such viruses deserves exceptional scrutiny. The magnitude of public health risk from an accidental release of a pathogen depends on how many people could become infected, times the risk of severe or fatal outcome per case, and is modified by the availability of countermeasures that could stop the spread of such a pathogen or reduce the severity of infection. Most biosafety level 4 (BSL-4) pathogens—including certain arenaviruses (e.g., Lassa viruses), filoviruses (e.g., Ebola virus and Marburg virus), and Hendra viruses (e.g., Hendra virus and Nipah virus)—are zoonotic agents that often cause severe or fatal disease in infected humans. However, an accidental release of these viruses would likely have limited global impact because their person-to-person transmission is inefficient in most settings. In addition, they exist “in the wild,” so an accidental release would not be the only source for risk of transmission to humans. While influenza A/H5N1 virus exists in the wild, mammalian-transmissible strains do not exist outside the laboratory as far as we are aware. If a mammalian-transmissible variant maintains a case fatality rate within even an order of magnitude of the 60% case fatality rate of its wild-type parent (1) and if it is as transmissible between humans as other common influenza viruses that infect humans, an accidental release would pose a grave, and completely novel, threat to human health. Once a novel strain of influenza virus establishes significant transmission in humans, stopping its spread would require massive global use of vaccines, a scenario that has never been accomplished in practice and could not be done in time for H5N1 because sufficient stockpiles do not exist worldwide and trust in vaccines is declining globally (2). Therefore, a highly transmissible, highly virulent virus like the modified H5N1 strains that have been created has the potential to infect billions and potentially kill a large fraction of those.
Of course, an accidental release of such a pathogen is not certain to cause such destruction; we do not yet know whether such viruses are indeed human-to-human transmissible, though this was the rationale for their creation, and we do not know whether they remain as virulent as their wild-type parent strains. And even if both of these were true, a single accidental infection is not guaranteed to spread widely. Nonetheless, it would be capable of doing so. Even if a release of such a pathogen were contained before it spread widely, such an accident would severely threaten the credibility of life scientists, research institutions, including universities, and public health agencies.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3484391/
The Human Fatality Burden of Gain of Function Flu Research:
http://www.pathobiologics.org/btac/ref/TheHumanFatalityBurdenofGainofFunctionFluResearch.pdf
Historical perspective--Emergence of influenza A (H1N1) viruses.
https://www.ncbi.nlm.nih.gov/pubmed/19564632
Guest- Guest
Re: A možda ipak ...
by Guest 6/4/2020, 00:14
Modern genetic analysis allows pathogens to be precisely identified, and because all circulating pathogens show genetic changes over time, the year that a particular example of a pathogen emerged can generally be determined, given a sufficient database of samples.
If a pathogen appears in nature after not circulating for years or decades, it may be assumed to have escaped from a laboratory where it had been stored inert for many years, accumulating no genetic changes; that is, its natural evolution had been frozen.
If a pathogen appears in nature after not circulating for years or decades, it may be assumed to have escaped from a laboratory where it had been stored inert for many years, accumulating no genetic changes; that is, its natural evolution had been frozen.
Guest- Guest
Re: A možda ipak ...
by Guest 6/4/2020, 00:22
The swine flu scare of 1976 and the H1N1 human influenza pandemic of 1977.
Human H1N1 influenza virus appeared with the 1918 global pandemic, and persisted, slowly accumulating small genetic changes, until 1957, when it appeared to go extinct after the H2N2 pandemic virus appeared. In 1976, H1N1 swine influenza virus struck Fort Dix, causing 13 hospitalizations and one death. The specter of a reprise of the deadly 1918 pandemic triggered an unprecedented effort to immunize all Americans. No swine H1N1 pandemic materialized, however, and complications of immunization truncated the program after 48 million immunizations, which eventually caused 25 deaths.
Human H1N1 virus reappeared in 1977, in the Soviet Union and China. Virologists, using serologic and early genetic tests soon began to suggest the cause of the reappearance was a laboratory escape of a 1949-1950 virus, and as genomic techniques advanced, it became clear that this was true. By 2010, researchers published it as fact: “The most famous case of a released laboratory strain is the re-emergent H1N1 influenza-A virus which was first observed in China in May of 1977 and in Russia shortly thereafter.” The virus may have escaped from a lab attempting to prepare an attenuated H1N1 vaccine in response to the US swine flu pandemic alert.
The 1977 pandemic spread rapidly worldwide but was limited to those under 20 years of age: Older persons were immune from exposures before 1957. Its attack rate was high (20 to 70 percent) in schools and military camps, but mercifully it caused mild disease, and fatalities were few. It continued to circulate until 2009, when the pH1N1 virus replaced it. There has been virtually no public awareness of the 1977 H1N1 pandemic and its laboratory origins, despite the clear analogy to current concern about a potential H5N1 or H7N9 avian influenza pandemic and “gain of function” experiments. The consequences of escape of a highly lethal avian virus with enhanced transmissibility would almost certainly be much graver than the 1977 escape of a “seasonal,” possibly attenuated strain to a population with substantial existing immunity.
The Re-Emergence of H1N1 Influenza Virus in 1977: A Cautionary Tale for Estimating Divergence Times Using Biologically Unrealistic Sampling Dates
Abstract
In 1977, H1N1 influenza A virus reappeared after a 20-year absence. Genetic analysis indicated that this strain was missing decades of nucleotide sequence evolution, suggesting an accidental release of a frozen laboratory strain into the general population. Recently, this strain and its descendants were included in an analysis attempting to date the origin of pandemic influenza virus without accounting for the missing decades of evolution. Here, we investigated the effect of using viral isolates with biologically unrealistic sampling dates on estimates of divergence dates. Not accounting for missing sequence evolution produced biased results and increased the variance of date estimates of the most recent common ancestor of the re-emergent lineages and across the entire phylogeny. Reanalysis of the H1N1 sequences excluding isolates with unrealistic sampling dates indicates that the 1977 re-emergent lineage was circulating for approximately one year before detection, making it difficult to determine the geographic source of reintroduction. We suggest that a new method is needed to account for viral isolates with unrealistic sampling dates.
https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0011184
Human H1N1 influenza virus appeared with the 1918 global pandemic, and persisted, slowly accumulating small genetic changes, until 1957, when it appeared to go extinct after the H2N2 pandemic virus appeared. In 1976, H1N1 swine influenza virus struck Fort Dix, causing 13 hospitalizations and one death. The specter of a reprise of the deadly 1918 pandemic triggered an unprecedented effort to immunize all Americans. No swine H1N1 pandemic materialized, however, and complications of immunization truncated the program after 48 million immunizations, which eventually caused 25 deaths.
Human H1N1 virus reappeared in 1977, in the Soviet Union and China. Virologists, using serologic and early genetic tests soon began to suggest the cause of the reappearance was a laboratory escape of a 1949-1950 virus, and as genomic techniques advanced, it became clear that this was true. By 2010, researchers published it as fact: “The most famous case of a released laboratory strain is the re-emergent H1N1 influenza-A virus which was first observed in China in May of 1977 and in Russia shortly thereafter.” The virus may have escaped from a lab attempting to prepare an attenuated H1N1 vaccine in response to the US swine flu pandemic alert.
The 1977 pandemic spread rapidly worldwide but was limited to those under 20 years of age: Older persons were immune from exposures before 1957. Its attack rate was high (20 to 70 percent) in schools and military camps, but mercifully it caused mild disease, and fatalities were few. It continued to circulate until 2009, when the pH1N1 virus replaced it. There has been virtually no public awareness of the 1977 H1N1 pandemic and its laboratory origins, despite the clear analogy to current concern about a potential H5N1 or H7N9 avian influenza pandemic and “gain of function” experiments. The consequences of escape of a highly lethal avian virus with enhanced transmissibility would almost certainly be much graver than the 1977 escape of a “seasonal,” possibly attenuated strain to a population with substantial existing immunity.
The Re-Emergence of H1N1 Influenza Virus in 1977: A Cautionary Tale for Estimating Divergence Times Using Biologically Unrealistic Sampling Dates
Abstract
In 1977, H1N1 influenza A virus reappeared after a 20-year absence. Genetic analysis indicated that this strain was missing decades of nucleotide sequence evolution, suggesting an accidental release of a frozen laboratory strain into the general population. Recently, this strain and its descendants were included in an analysis attempting to date the origin of pandemic influenza virus without accounting for the missing decades of evolution. Here, we investigated the effect of using viral isolates with biologically unrealistic sampling dates on estimates of divergence dates. Not accounting for missing sequence evolution produced biased results and increased the variance of date estimates of the most recent common ancestor of the re-emergent lineages and across the entire phylogeny. Reanalysis of the H1N1 sequences excluding isolates with unrealistic sampling dates indicates that the 1977 re-emergent lineage was circulating for approximately one year before detection, making it difficult to determine the geographic source of reintroduction. We suggest that a new method is needed to account for viral isolates with unrealistic sampling dates.
https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0011184
Guest- Guest
Re: A možda ipak ...
by Guest 6/4/2020, 00:29
Smallpox releases in Great Britain.
Eradication of natural smallpox transmission made the prospect of reintroduction of the virus intolerable. This risk was clearly demonstrated in the United Kingdom, where from 1963-1978 only four cases of smallpox (with no deaths) occurred that were imported by travelers from areas where smallpox was endemic, while during this same period at least 80 cases and three deaths resulted from three separate escapes from two different accredited smallpox laboratories.
The first recognized laboratory escape, in March 1972, occurred with the infection of a laboratory assistant at the London School of Hygiene and Tropical Medicine. She had observed the harvesting of live smallpox virus from eggs used as a growing medium; the process was performed on an uncontained lab table, as was then routine. Hospitalized, but before she was placed in isolation, she infected two visitors to a patient in an adjacent bed, both of whom died. They in turn infected a nurse, who survived, as did the laboratory assistant.
In August of 1978, a medical photographer at Birmingham Medical School developed smallpox and died. She infected her mother, who survived. Her workplace was immediately above the smallpox laboratory at Birmingham Medical School. Faulty ventilation and shortcomings in technique were ultimately implicated.
Investigators then re-examined a 1966 smallpox outbreak, which was strikingly similar. The initial 1966 infection was also a medical photographer who worked at the same Birmingham Medical School facility. The earlier outbreak was caused by a low-virulence strain of smallpox (variola minor), and it caused at least 72 subsequent cases. There were no deaths. Laboratory logs revealed variola minor had been manipulated in the smallpox laboratory at a time appropriate to cause the infection in the photographer working a floor above.
https://assets.publishing.service.gov.uk/government/uploads/system/uploads/attachment_data/file/228654/0668.pdf.pdf
Eradication of natural smallpox transmission made the prospect of reintroduction of the virus intolerable. This risk was clearly demonstrated in the United Kingdom, where from 1963-1978 only four cases of smallpox (with no deaths) occurred that were imported by travelers from areas where smallpox was endemic, while during this same period at least 80 cases and three deaths resulted from three separate escapes from two different accredited smallpox laboratories.
The first recognized laboratory escape, in March 1972, occurred with the infection of a laboratory assistant at the London School of Hygiene and Tropical Medicine. She had observed the harvesting of live smallpox virus from eggs used as a growing medium; the process was performed on an uncontained lab table, as was then routine. Hospitalized, but before she was placed in isolation, she infected two visitors to a patient in an adjacent bed, both of whom died. They in turn infected a nurse, who survived, as did the laboratory assistant.
In August of 1978, a medical photographer at Birmingham Medical School developed smallpox and died. She infected her mother, who survived. Her workplace was immediately above the smallpox laboratory at Birmingham Medical School. Faulty ventilation and shortcomings in technique were ultimately implicated.
Investigators then re-examined a 1966 smallpox outbreak, which was strikingly similar. The initial 1966 infection was also a medical photographer who worked at the same Birmingham Medical School facility. The earlier outbreak was caused by a low-virulence strain of smallpox (variola minor), and it caused at least 72 subsequent cases. There were no deaths. Laboratory logs revealed variola minor had been manipulated in the smallpox laboratory at a time appropriate to cause the infection in the photographer working a floor above.
https://assets.publishing.service.gov.uk/government/uploads/system/uploads/attachment_data/file/228654/0668.pdf.pdf
Guest- Guest
Re: A možda ipak ...
by Guest 6/4/2020, 00:40
Venezuelan equine encephalitis in 1995.
Venezuelan equine encephalitis (VEE) is a viral disease transmitted by mosquitoes. It intermittently erupts in regional or continental-scale outbreaks that involve equines (horses, donkeys, and mules) in the Western Hemisphere. There are often concurrent zoonotic epidemics among humans. VEE in humans causes a severe febrile illness; it can occasionally be fatal or may leave permanent neurological disability (epilepsy, paralysis, or mental retardation) in 4 to 14 percent of clinical cases, particularly those involving children.
There were significant outbreaks of VEE every few years from the 1930s to the 1970s. Modern analysis revealed most outbreaks were genetic matches to the original 1938 VEE isolation used in inactivated veterinary vaccines. It was clear that many batches of the veterinary VEE vaccines had not been completely inactivated, so residual infective virus remained.
From 1938 to 1972, the VEE vaccine caused most of the very outbreaks that it was called upon to prevent, a clear self-fulfilling prophecy.
In 1995 a major VEE animal and human outbreak struck Venezuela and Colombia. There were at least 10,000 human VEE cases with 11 deaths in Venezuela and an estimated 75,000 human cases in Colombia, with 3,000 neurological complications and 300 deaths. VEE virus was isolated from 10 stillborn or miscarried human fetuses.
Genomic analysis identified the 1995 virus as identical to a 1963 isolate, with no indication it had been circulating for 28 years. It was another case of frozen evolution, but unlike the vaccine-related VEE outbreaks, the 1963 virus had never been used in a vaccine. Suspicion fell on an inadvertent release from a virology lab, either by an unrecognized infection of a lab worker or visitor, or escape of an infected laboratory animal or mosquito. The major scientific group working on VEE published a paper in 2001 stating the 1995 outbreak most likely was a laboratory escape, with considerable circumstantial evidence: The outbreak strain was isolated from an incompletely inactivated antigen preparation used on the open bench in the VEE laboratory located at the outbreak epicenter. But clear proof was lacking, and the group subsequently said it was reconsidering this conclusion.
Potential Sources of the 1995 Venezuelan Equine Encephalitis Subtype IC Epidemic
https://jvi.asm.org/content/75/13/5823.abstract
Genetic evidence for the origins of Venezuelan equine encephalitis virus subtype IAB outbreaks.
https://www.ncbi.nlm.nih.gov/pubmed/10466974
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC114297/
https://watermark.silverchair.com/175-4-828.pdf?token=AQECAHi208BE49Ooan9kkhW_Ercy7Dm3ZL_9Cf3qfKAc485ysgAAAlMwggJPBgkqhkiG9w0BBwagggJAMIICPAIBADCCAjUGCSqGSIb3DQEHATAeBglghkgBZQMEAS4wEQQMrIrqs2MSJuSHaaqRAgEQgIICBtN4q8B1x_lNI4uLUf1_JsWuBgAfLEhtSD0K6h30rLIt8v6oZTmogvHCcdmLdsOG74sttoyGtlDx-zS_gzOpnjHpF_qHnpIVeozBta0qSjKRLx6on_RjqVOjpIF0AUNhqQjc594ggzxRRBGPhivKxAlo0z8kzLbG151l9J8MOrspqi_qOvXLgfUDt8Od0xzVgxIAhC-kDU1lVfEv4h51VwHXRDNIBDc5ucOvqftaP09LDTCrUkE2CzETHq8xfusSvmRb9QNWUvkobA-D6QUlDY4iGW4Np9efEyQj1lBi3SzNnNzNyk7zzv4mUVQQ5F5rNfwRMQChC3o1eNmojVYDMIyR_2_4UpUj6J2VpX1YbHjvvO9NldBi-yiFNr-U2_MrFbEH7rioZ-BKiKHv5WUa0RkHbpu3crPmaiUmqZv1Y-i14CqPk_0MzV57HnG1JI6xD5GBE5lEfunNMm-TCpLDuJ9kUr-RcaepX50DzS2dfBmz2zJ_xpsuAm5MlaBpRDmy8dTzd1zjMAPzFH828I-vcPZ2PgpTW7jZXf-QehItrbK-qfJH1LWO22yMXSgS0HspAiwV9i5bY-x1NaBPXAZStNau73Yq4SnOQ-UQFdTUSjPB_ixSlH_tJhF__Itcpq5JlLAofCqI_1Wqb1pwvyGZl5Uyf_JHdaJJMNZ0EJnkEs83Lq3Y-Oek
https://www.ncbi.nlm.nih.gov/pubmed/8709783
Venezuelan equine encephalitis (VEE) is a viral disease transmitted by mosquitoes. It intermittently erupts in regional or continental-scale outbreaks that involve equines (horses, donkeys, and mules) in the Western Hemisphere. There are often concurrent zoonotic epidemics among humans. VEE in humans causes a severe febrile illness; it can occasionally be fatal or may leave permanent neurological disability (epilepsy, paralysis, or mental retardation) in 4 to 14 percent of clinical cases, particularly those involving children.
There were significant outbreaks of VEE every few years from the 1930s to the 1970s. Modern analysis revealed most outbreaks were genetic matches to the original 1938 VEE isolation used in inactivated veterinary vaccines. It was clear that many batches of the veterinary VEE vaccines had not been completely inactivated, so residual infective virus remained.
From 1938 to 1972, the VEE vaccine caused most of the very outbreaks that it was called upon to prevent, a clear self-fulfilling prophecy.
In 1995 a major VEE animal and human outbreak struck Venezuela and Colombia. There were at least 10,000 human VEE cases with 11 deaths in Venezuela and an estimated 75,000 human cases in Colombia, with 3,000 neurological complications and 300 deaths. VEE virus was isolated from 10 stillborn or miscarried human fetuses.
Genomic analysis identified the 1995 virus as identical to a 1963 isolate, with no indication it had been circulating for 28 years. It was another case of frozen evolution, but unlike the vaccine-related VEE outbreaks, the 1963 virus had never been used in a vaccine. Suspicion fell on an inadvertent release from a virology lab, either by an unrecognized infection of a lab worker or visitor, or escape of an infected laboratory animal or mosquito. The major scientific group working on VEE published a paper in 2001 stating the 1995 outbreak most likely was a laboratory escape, with considerable circumstantial evidence: The outbreak strain was isolated from an incompletely inactivated antigen preparation used on the open bench in the VEE laboratory located at the outbreak epicenter. But clear proof was lacking, and the group subsequently said it was reconsidering this conclusion.
Potential Sources of the 1995 Venezuelan Equine Encephalitis Subtype IC Epidemic
https://jvi.asm.org/content/75/13/5823.abstract
Genetic evidence for the origins of Venezuelan equine encephalitis virus subtype IAB outbreaks.
https://www.ncbi.nlm.nih.gov/pubmed/10466974
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC114297/
https://watermark.silverchair.com/175-4-828.pdf?token=AQECAHi208BE49Ooan9kkhW_Ercy7Dm3ZL_9Cf3qfKAc485ysgAAAlMwggJPBgkqhkiG9w0BBwagggJAMIICPAIBADCCAjUGCSqGSIb3DQEHATAeBglghkgBZQMEAS4wEQQMrIrqs2MSJuSHaaqRAgEQgIICBtN4q8B1x_lNI4uLUf1_JsWuBgAfLEhtSD0K6h30rLIt8v6oZTmogvHCcdmLdsOG74sttoyGtlDx-zS_gzOpnjHpF_qHnpIVeozBta0qSjKRLx6on_RjqVOjpIF0AUNhqQjc594ggzxRRBGPhivKxAlo0z8kzLbG151l9J8MOrspqi_qOvXLgfUDt8Od0xzVgxIAhC-kDU1lVfEv4h51VwHXRDNIBDc5ucOvqftaP09LDTCrUkE2CzETHq8xfusSvmRb9QNWUvkobA-D6QUlDY4iGW4Np9efEyQj1lBi3SzNnNzNyk7zzv4mUVQQ5F5rNfwRMQChC3o1eNmojVYDMIyR_2_4UpUj6J2VpX1YbHjvvO9NldBi-yiFNr-U2_MrFbEH7rioZ-BKiKHv5WUa0RkHbpu3crPmaiUmqZv1Y-i14CqPk_0MzV57HnG1JI6xD5GBE5lEfunNMm-TCpLDuJ9kUr-RcaepX50DzS2dfBmz2zJ_xpsuAm5MlaBpRDmy8dTzd1zjMAPzFH828I-vcPZ2PgpTW7jZXf-QehItrbK-qfJH1LWO22yMXSgS0HspAiwV9i5bY-x1NaBPXAZStNau73Yq4SnOQ-UQFdTUSjPB_ixSlH_tJhF__Itcpq5JlLAofCqI_1Wqb1pwvyGZl5Uyf_JHdaJJMNZ0EJnkEs83Lq3Y-Oek
https://www.ncbi.nlm.nih.gov/pubmed/8709783
Guest- Guest
Re: A možda ipak ...
by Guest 6/4/2020, 00:52
SARS outbreaks after the SARS epidemic.
The 2003 Severe Acute Respiratory Syndrome outbreak spread to 29 countries, causing more than 8,000 infections and at least 774 deaths. Because 21 percent of cases involved hospital workers, it had the potential to shut down health care services wherever it struck. It is particularly dangerous to handle in the laboratory because there is no vaccine, and it can be transmitted via aerosols.
Moreover, about five percent of SARS patients are “super-spreaders” who infect eight or more secondary cases. For instance, one patient spread SARS directly to 33 others (reflecting an infection rate of 45 percent) during a hospitalization, ultimately leading to the infection of 77 people, including three secondary super-spreaders. A super-spreader could turn even a single laboratory infection into a potential pandemic.
SARS has not re-emerged naturally, but there have been six escapes from virology labs: one each in Singapore and Taiwan, and four separate escapes at the same laboratory in Beijing.
The first was in Singapore in August 2003, in a virology graduate student at the National University of Singapore. He had not worked directly with SARS, but it was present in the laboratory where he worked. He recovered and produced no secondary cases. The World Health Organization formed an expert committee to revise SARS biosafety guidelines.
The second escape was in Taiwan in December 2003, when a SARS research scientist fell ill on a return flight after attending a medical meeting in Singapore. His 74 contacts in Singapore were quarantined, but again, fortunately, none developed SARS. Investigation revealed the scientist had handled leaking biohazard waste without gloves, a mask, or a gown. Ironically, the WHO expert committee called for augmented biosafety in SARS laboratories the day after this case was reported.
In April 2004, China reported a case of SARS in a nurse who had cared for a researcher at the Chinese National Institute of Virology (NIV). While ill, the researcher had traveled twice by train from Beijing to Anhui province, where she was nursed by her mother, a physician, who fell ill and died. The nurse in turn infected five third-generation cases, causing no deaths.
Subsequent investigation uncovered three unrelated laboratory infections in different researchers at the NIV. At least of two primary patients had never worked with live SARS virus.
Many shortcomings in biosecurity were found at the NIV, and the specific cause of the outbreak was traced to an inadequately inactivated preparation of SARS virus that was used in general (that is, not biosecure) laboratory areas, including one where the primary cases worked. It had not been tested to confirm its safety after inactivation, as it should have been.
Superspreading SARS Events, Beijing, 2003
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3322930/#R1
Severe Acute Respiratory Syndrome (SARS) in Taiwan, China
https://www.who.int/csr/don/2003_12_17/en/
https://usatoday30.usatoday.com/news/health/2003-12-17-singapore-sars_x.htm
WHO post-outbreak biosafety guidelines for handling of SARS-CoV specimens and cultures
18 December 2003
https://www.who.int/csr/sars/biosafety2003_12_18/en/
China reports additional SARS cases - update
23 April 2004
https://www.who.int/csr/don/2004_04_23/en/
The 2003 Severe Acute Respiratory Syndrome outbreak spread to 29 countries, causing more than 8,000 infections and at least 774 deaths. Because 21 percent of cases involved hospital workers, it had the potential to shut down health care services wherever it struck. It is particularly dangerous to handle in the laboratory because there is no vaccine, and it can be transmitted via aerosols.
Moreover, about five percent of SARS patients are “super-spreaders” who infect eight or more secondary cases. For instance, one patient spread SARS directly to 33 others (reflecting an infection rate of 45 percent) during a hospitalization, ultimately leading to the infection of 77 people, including three secondary super-spreaders. A super-spreader could turn even a single laboratory infection into a potential pandemic.
SARS has not re-emerged naturally, but there have been six escapes from virology labs: one each in Singapore and Taiwan, and four separate escapes at the same laboratory in Beijing.
The first was in Singapore in August 2003, in a virology graduate student at the National University of Singapore. He had not worked directly with SARS, but it was present in the laboratory where he worked. He recovered and produced no secondary cases. The World Health Organization formed an expert committee to revise SARS biosafety guidelines.
The second escape was in Taiwan in December 2003, when a SARS research scientist fell ill on a return flight after attending a medical meeting in Singapore. His 74 contacts in Singapore were quarantined, but again, fortunately, none developed SARS. Investigation revealed the scientist had handled leaking biohazard waste without gloves, a mask, or a gown. Ironically, the WHO expert committee called for augmented biosafety in SARS laboratories the day after this case was reported.
In April 2004, China reported a case of SARS in a nurse who had cared for a researcher at the Chinese National Institute of Virology (NIV). While ill, the researcher had traveled twice by train from Beijing to Anhui province, where she was nursed by her mother, a physician, who fell ill and died. The nurse in turn infected five third-generation cases, causing no deaths.
Subsequent investigation uncovered three unrelated laboratory infections in different researchers at the NIV. At least of two primary patients had never worked with live SARS virus.
Many shortcomings in biosecurity were found at the NIV, and the specific cause of the outbreak was traced to an inadequately inactivated preparation of SARS virus that was used in general (that is, not biosecure) laboratory areas, including one where the primary cases worked. It had not been tested to confirm its safety after inactivation, as it should have been.
Superspreading SARS Events, Beijing, 2003
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3322930/#R1
Severe Acute Respiratory Syndrome (SARS) in Taiwan, China
https://www.who.int/csr/don/2003_12_17/en/
https://usatoday30.usatoday.com/news/health/2003-12-17-singapore-sars_x.htm
WHO post-outbreak biosafety guidelines for handling of SARS-CoV specimens and cultures
18 December 2003
https://www.who.int/csr/sars/biosafety2003_12_18/en/
China reports additional SARS cases - update
23 April 2004
https://www.who.int/csr/don/2004_04_23/en/
Guest- Guest
Re: A možda ipak ...
by Guest 6/4/2020, 01:00
Foot and mouth disease in the UK in 2007.
Foot and Mouth Disease (FMD) infects cloven-hoofed animals such as pigs, sheep, and cattle. It has been eradicated in North America and most of Europe. It is highly transmissible, capable of spreading through direct contact on the boots of farm workers and by natural aerosol that can spread up to 250 kilometers.
Outbreaks in FMD-free areas cause economic disaster because meat exports cease and animals are massively culled. A 2001 UK outbreak resulted in 10 million animals killed and $16 billion in economic losses.
In 2007, FMD appeared again in Britain, four kilometers from a biosafety level 4 laboratory—a designation indicating the highest level of lab security—located at Pirbright. The strain had caused a 1967 outbreak in the United Kingdom but was not then circulating in animals anywhere. It was, however, used in vaccine manufacture at the Pirbright facility. Investigations concluded that construction vehicles had carried mud contaminated with FMD from a defective wastewater line at Pirbright to the first farm. That outbreak identified 278 infected animals and required 1,578 animals to be culled. It disrupted UK agricultural production and exports and cost an estimated 200 million pounds.
Federal law bans FMD virus from the continental United States, and it is held only at the US Department of Agriculture Plum Island facility off Long Island. Currently, however, its replacement, the National Bio and Agro-Defense Facility, is under construction in Manhattan, Kansas, under the aegis of the Department of Homeland Security. Moving FMD research to the agricultural heartland of the United States was opposed by many groups, including the Government Accountability Office, but Homeland Security decided on the Kansas location. In upgrading facilities to counter the threat of agro-bioterrorism, the department is increasing the risk to US agriculture of unintentional release.
http://www.fao.org/ag/againfo/commissions/docs/training/material/UK2007_perspectives.pdf
Foot and Mouth Disease (FMD) infects cloven-hoofed animals such as pigs, sheep, and cattle. It has been eradicated in North America and most of Europe. It is highly transmissible, capable of spreading through direct contact on the boots of farm workers and by natural aerosol that can spread up to 250 kilometers.
Outbreaks in FMD-free areas cause economic disaster because meat exports cease and animals are massively culled. A 2001 UK outbreak resulted in 10 million animals killed and $16 billion in economic losses.
In 2007, FMD appeared again in Britain, four kilometers from a biosafety level 4 laboratory—a designation indicating the highest level of lab security—located at Pirbright. The strain had caused a 1967 outbreak in the United Kingdom but was not then circulating in animals anywhere. It was, however, used in vaccine manufacture at the Pirbright facility. Investigations concluded that construction vehicles had carried mud contaminated with FMD from a defective wastewater line at Pirbright to the first farm. That outbreak identified 278 infected animals and required 1,578 animals to be culled. It disrupted UK agricultural production and exports and cost an estimated 200 million pounds.
Federal law bans FMD virus from the continental United States, and it is held only at the US Department of Agriculture Plum Island facility off Long Island. Currently, however, its replacement, the National Bio and Agro-Defense Facility, is under construction in Manhattan, Kansas, under the aegis of the Department of Homeland Security. Moving FMD research to the agricultural heartland of the United States was opposed by many groups, including the Government Accountability Office, but Homeland Security decided on the Kansas location. In upgrading facilities to counter the threat of agro-bioterrorism, the department is increasing the risk to US agriculture of unintentional release.
http://www.fao.org/ag/againfo/commissions/docs/training/material/UK2007_perspectives.pdf
Guest- Guest
Re: A možda ipak ...
by Guest 6/4/2020, 01:11
Dangerous themes.
These narratives of escaped pathogens have common themes. There are unrecognized technical flaws in standard biocontainment, as demonstrated in the UK smallpox and FMD cases. Inadequately inactivated preparations of dangerous pathogens are handled in laboratory areas with reduced biosecurity levels, as demonstrated in the SARS and VEE escapes. The first infection, or index case, happens in a person not working directly with the pathogen that infects him or her, as in the smallpox and SARS escapes. Poor training of personnel and slack oversight of laboratory procedures negate policy efforts by national and international bodies to achieve biosecurity, as shown in the SARS and smallpox escapes.
It is hardly reassuring that, despite stepwise technical improvements in containment facilities and increased policy demands for rigorous biosecurity procedures in the handling of dangerous pathogens, potentially high consequence breaches of biocontainment occur nearly daily: In 2010, 244 unintended releases of bioweapon candidate “select agents” were reported.
Looking at the problem pragmatically, the question is not if such escapes will result in a major civilian outbreak, but rather what the pathogen will be and how such an escape may be contained, if indeed it can be contained at all.
Experiments that augment virulence and transmissibility of dangerous pathogens have been funded and performed, notably with the H5N1 avian influenza virus. The advisability of performing such experiments at all—particularly in laboratories placed at universities in heavily populated urban areas, where potentially exposed laboratory personnel are in daily contact with a multitude of susceptible and unaware citizens—is clearly in question.
If such manipulations should be allowed at all, it would seem prudent to conduct them in isolated laboratories where personnel are sequestered from the general public and must undergo a period of exit quarantine before re-entering civilian life. The historical record tells us it is not a matter of if but when ignoring such measures will cost health and even lives. Perhaps many lives.
The consequences of a lab escape of a potential pandemic
pathogen
https://core.ac.uk/download/pdf/82849266.pdf
Monitoring Select Agent Theft, Loss and Release Reports in the
United States—2004-2010
https://web.archive.org/web/20140422130326/https://absa.org/abj/abj/121704FAHenkel.pdf
These narratives of escaped pathogens have common themes. There are unrecognized technical flaws in standard biocontainment, as demonstrated in the UK smallpox and FMD cases. Inadequately inactivated preparations of dangerous pathogens are handled in laboratory areas with reduced biosecurity levels, as demonstrated in the SARS and VEE escapes. The first infection, or index case, happens in a person not working directly with the pathogen that infects him or her, as in the smallpox and SARS escapes. Poor training of personnel and slack oversight of laboratory procedures negate policy efforts by national and international bodies to achieve biosecurity, as shown in the SARS and smallpox escapes.
It is hardly reassuring that, despite stepwise technical improvements in containment facilities and increased policy demands for rigorous biosecurity procedures in the handling of dangerous pathogens, potentially high consequence breaches of biocontainment occur nearly daily: In 2010, 244 unintended releases of bioweapon candidate “select agents” were reported.
Looking at the problem pragmatically, the question is not if such escapes will result in a major civilian outbreak, but rather what the pathogen will be and how such an escape may be contained, if indeed it can be contained at all.
Experiments that augment virulence and transmissibility of dangerous pathogens have been funded and performed, notably with the H5N1 avian influenza virus. The advisability of performing such experiments at all—particularly in laboratories placed at universities in heavily populated urban areas, where potentially exposed laboratory personnel are in daily contact with a multitude of susceptible and unaware citizens—is clearly in question.
If such manipulations should be allowed at all, it would seem prudent to conduct them in isolated laboratories where personnel are sequestered from the general public and must undergo a period of exit quarantine before re-entering civilian life. The historical record tells us it is not a matter of if but when ignoring such measures will cost health and even lives. Perhaps many lives.
The consequences of a lab escape of a potential pandemic
pathogen
https://core.ac.uk/download/pdf/82849266.pdf
Monitoring Select Agent Theft, Loss and Release Reports in the
United States—2004-2010
https://web.archive.org/web/20140422130326/https://absa.org/abj/abj/121704FAHenkel.pdf
Guest- Guest
Re: A možda ipak ...
by Guest 6/4/2020, 01:12
uffff.ovo je bilo jebeno...Gnječ wrote:Foot and mouth disease in the UK in 2007.
Foot and Mouth Disease (FMD) infects cloven-hoofed animals such as pigs, sheep, and cattle. It has been eradicated in North America and most of Europe. It is highly transmissible, capable of spreading through direct contact on the boots of farm workers and by natural aerosol that can spread up to 250 kilometers.
Outbreaks in FMD-free areas cause economic disaster because meat exports cease and animals are massively culled. A 2001 UK outbreak resulted in 10 million animals killed and $16 billion in economic losses.
In 2007, FMD appeared again in Britain, four kilometers from a biosafety level 4 laboratory—a designation indicating the highest level of lab security—located at Pirbright. The strain had caused a 1967 outbreak in the United Kingdom but was not then circulating in animals anywhere. It was, however, used in vaccine manufacture at the Pirbright facility. Investigations concluded that construction vehicles had carried mud contaminated with FMD from a defective wastewater line at Pirbright to the first farm. That outbreak identified 278 infected animals and required 1,578 animals to be culled. It disrupted UK agricultural production and exports and cost an estimated 200 million pounds.
Federal law bans FMD virus from the continental United States, and it is held only at the US Department of Agriculture Plum Island facility off Long Island. Currently, however, its replacement, the National Bio and Agro-Defense Facility, is under construction in Manhattan, Kansas, under the aegis of the Department of Homeland Security. Moving FMD research to the agricultural heartland of the United States was opposed by many groups, including the Government Accountability Office, but Homeland Security decided on the Kansas location. In upgrading facilities to counter the threat of agro-bioterrorism, the department is increasing the risk to US agriculture of unintentional release.
http://www.fao.org/ag/againfo/commissions/docs/training/material/UK2007_perspectives.pdf
Guest- Guest
Re: A možda ipak ...
by Guest 6/4/2020, 01:15
Laboratory Escapes and “Self-fulfilling prophecy” Epidemics
Escaped Viruses-final 2-17-14
By: Martin Furmanski MD
Scientist’s Working Group on Chemical and Biologic Weapons
Center for Arms Control and Nonproliferation
February 17, 2014
https://armscontrolcenter.org/wp-content/uploads/2016/02/Escaped-Viruses-final-2-17-14-copy.pdf
Escaped Viruses-final 2-17-14
By: Martin Furmanski MD
Scientist’s Working Group on Chemical and Biologic Weapons
Center for Arms Control and Nonproliferation
February 17, 2014
https://armscontrolcenter.org/wp-content/uploads/2016/02/Escaped-Viruses-final-2-17-14-copy.pdf
Guest- Guest
Re: A možda ipak ...
by Guest 6/4/2020, 01:31
Super-spreaders: what are they and how are they transmitting coronavirus?
What are super-spreaders?
Not everybody is equal when it comes to the transmission of infectious diseases. In fact, it has been established for at least two decades that there is something called the 20/80 rule – that a small core group of about one in five people transmit infections to far more people than the majority do.
How does a person become a super-spreader?
There are a number of theories, but no definite answer. Some speculate that it is to do with the immune system of the super-spreader, which may not be good at suppressing the virus or alternatively may be so good that they do not feel symptoms themselves so carry on transmitting it to others. But it is likely to be caused by multiple factors, possibly including getting a higher dose of the virus in the first place or being infected with more than one pathogen. One thing seems certain – it is impossible to know who will be a super-spreader and who will not.
Are there super-spreaders of the new coronavirus?
It seems so. The third British case was a man in his 50s who contracted the coronavirus infection at a conference in Singapore. He then travelled to France where he stayed with his family in a ski chalet in the Alpine resort of Les Contamines-Montjoie. Five people who were in the chalet, including a boy of nine, have tested positive for coronavirus since the man came back to the UK on an easyJet flight and was diagnosed in Brighton. Another Briton who was on holiday in the chalet flew back to his home in Mallorca and was admitted to hospital in Palma. The chief medical officer said four more people had tested positive in England – all of whom were also on the skiing holiday in France.
Among delegates to the Singapore conference was a man who flew in from Wuhan, China, who may himself have been a super-spreader. A number of others who were there and returned to other countries, in addition to the British man at the centre of the ski chalet cluster, are said to have fallen ill.
Does this happen with other infectious diseases?
Yes. Super-spreaders have been documented as far back as the early 1900s, when one woman infected 51 people with typhoid, even though she had no symptoms herself. More recently, one student at a high school in Finland infected 22 others with measles in 1998, even though eight of them had been vaccinated. Two people are thought to have infected 50 others with Ebola in the Democratic Republic of the Congo in 1995. In the 2002-03 Sars epidemic, most people were not very infectious, but a few super-spreaders in Singapore appear to have transmitted the virus to as many as 10 people each.
https://www.theguardian.com/world/2020/feb/27/what-are-super-spreaders-and-how-are-they-transmitting-coronavirus
What are super-spreaders?
Not everybody is equal when it comes to the transmission of infectious diseases. In fact, it has been established for at least two decades that there is something called the 20/80 rule – that a small core group of about one in five people transmit infections to far more people than the majority do.
How does a person become a super-spreader?
There are a number of theories, but no definite answer. Some speculate that it is to do with the immune system of the super-spreader, which may not be good at suppressing the virus or alternatively may be so good that they do not feel symptoms themselves so carry on transmitting it to others. But it is likely to be caused by multiple factors, possibly including getting a higher dose of the virus in the first place or being infected with more than one pathogen. One thing seems certain – it is impossible to know who will be a super-spreader and who will not.
Are there super-spreaders of the new coronavirus?
It seems so. The third British case was a man in his 50s who contracted the coronavirus infection at a conference in Singapore. He then travelled to France where he stayed with his family in a ski chalet in the Alpine resort of Les Contamines-Montjoie. Five people who were in the chalet, including a boy of nine, have tested positive for coronavirus since the man came back to the UK on an easyJet flight and was diagnosed in Brighton. Another Briton who was on holiday in the chalet flew back to his home in Mallorca and was admitted to hospital in Palma. The chief medical officer said four more people had tested positive in England – all of whom were also on the skiing holiday in France.
Among delegates to the Singapore conference was a man who flew in from Wuhan, China, who may himself have been a super-spreader. A number of others who were there and returned to other countries, in addition to the British man at the centre of the ski chalet cluster, are said to have fallen ill.
Does this happen with other infectious diseases?
Yes. Super-spreaders have been documented as far back as the early 1900s, when one woman infected 51 people with typhoid, even though she had no symptoms herself. More recently, one student at a high school in Finland infected 22 others with measles in 1998, even though eight of them had been vaccinated. Two people are thought to have infected 50 others with Ebola in the Democratic Republic of the Congo in 1995. In the 2002-03 Sars epidemic, most people were not very infectious, but a few super-spreaders in Singapore appear to have transmitted the virus to as many as 10 people each.
https://www.theguardian.com/world/2020/feb/27/what-are-super-spreaders-and-how-are-they-transmitting-coronavirus
Guest- Guest
Re: A možda ipak ...
by michaellcmacha 6/4/2020, 02:02
2012... 6 oboljelih 2 umrla.... pa onda dugo dugo ništa... pa onda rusvaj... ma koga zabole za taj razvojno dinamički slijed...jesmo rekli da čovjek nema ništa s tim jesmo... aj zdravo.... ;)Gnječ wrote:Modern genetic analysis allows pathogens to be precisely identified, and because all circulating pathogens show genetic changes over time, the year that a particular example of a pathogen emerged can generally be determined, given a sufficient database of samples.
If a pathogen appears in nature after not circulating for years or decades, it may be assumed to have escaped from a laboratory where it had been stored inert for many years, accumulating no genetic changes; that is, its natural evolution had been frozen.
michaellcmacha- Posts : 21325
2015-08-08
Re: A možda ipak ...
by Guest 6/4/2020, 02:22
michaellcmacha wrote:2012... 6 oboljelih 2 umrla.... pa onda dugo dugo ništa... pa onda rusvaj... ma koga zabole za taj razvojno dinamički slijed...jesmo rekli da čovjek nema ništa s tim jesmo... aj zdravo.... ;)Gnječ wrote:Modern genetic analysis allows pathogens to be precisely identified, and because all circulating pathogens show genetic changes over time, the year that a particular example of a pathogen emerged can generally be determined, given a sufficient database of samples.
If a pathogen appears in nature after not circulating for years or decades, it may be assumed to have escaped from a laboratory where it had been stored inert for many years, accumulating no genetic changes; that is, its natural evolution had been frozen.
mnogo su si dali truda da ušutkaju sve one koji misle da to nije tako nego je virus sklepan u laboratoriju a sad kako je i na koji način pobjegao iz labosa to vjerojatno nećemo nikada saznati možemo jedino špekulirati dok ne nađemo neki dokument negdje sakriven ili da ulovimo Xi Jinpinga i opalimo mu nekoliko tretmana kineske torture navodnjavanja kap po kap dok ne počne pjevat.
postoji još jedna enigma u njihovim obrazloženjima da je virus "skočio" na ljude drito sa šišmiša. to nije moguće jer šišmiši u kasnu jesen i cijelu zimu hiberniraju.
Guest- Guest
Re: A možda ipak ...
by Guest 6/4/2020, 02:47
Biologists are trying to make bird flu easier to spread. Can we not?
This research into viruses could help us understand pandemics better - or it could cause one.
By Kelsey Piper Feb 17, 2019, 11:00am EST
The bird flu is a deadly virus with the potential to spark a global pandemic.
Now, thanks to the US government, two lab experiments trying to find ways to make it more dangerous will resume their work after years on hold.
It’s a troubling development, and one that highlights the risks of something called “gain-of-function” research. That’s research in which pathogens are manipulated to change their capabilities — usually to make them deadlier.
Science Magazine last week broke the news that the US had quietly approved the two dangerous and controversial experiments. One of them will begin within the next few weeks. The other is expected to begin later this spring.
The two had been on hold since 2012 amid a fierce debate in the virology community about gain-of-function research. In 2014, the U.S. government declared a moratorium on such research.
That was a bad year on the biohazard front. In June 2014, as many as 75 scientists at the Center for Disease Control and Prevention were exposed to anthrax. A few weeks later, Food and Drug Administration officials ran across 16 forgotten vials of smallpox in storage. Meanwhile, the “largest, most severe and most complex” Ebola outbreak in history was raging across West Africa, and the first patient to be diagnosed in the U.S. had just been announced.
It was in that context that scientists and biosecurity experts found themselves embroiled in a debate about “gain of function” research.
The scientists who do this kind of research argue that we can better anticipate deadly diseases by making diseases deadlier in the lab.
But many people at the time and since have become increasingly convinced that the potential research benefits — which look limited — just don’t outweigh the risks of kicking off the next deadly pandemic ourselves.
But in 2017, the government released new guidelines for gain-of-function research, signaling an end to the blanket moratorium. And the news from last week suggests that dangerous projects are proceeding.
Experts in biosecurity are concerned that the field is heading toward a mistake that could kill innocent people. They argue that, to move ahead with research like this, there should be a transparent process with global stakeholders at the table. After all, if anything goes wrong, the mess we’ll face will certainly be a global one.
That’s dead wrong, Esvelt argues. “Based on the information they had, it was the right call.” When you’re just venturing into a new field and you don’t know how deadly your research might be, you should be exceptionally cautious. As you learn more, you might find that not all of that caution was necessary. But it’s much better than pushing ahead recklessly.
Pushing ahead recklessly is what we’re doing today — and the stakes are higher. Some scientists are studying diseases with the potential to become pandemics that could kill millions.
They’re sometimes making these diseases either more dangerous or easier to transmit among animals, in order to better understand how diseases spread. Amid controversies, this research is continuing. And experts argue there isn’t enough transparency about why.
The deadliest influenza strain in history was the 1918 pandemic, which was estimated to have killed 50 million people. H5N1 has killed more than half of people it infects, and while it’d likely become less lethal when modified to be more transmissible, it’s very, very dangerous.
linkovi:
https://www.vox.com/2019/2/17/18225938/biologists-are-trying-to-make-bird-flu-easier-to-spread-can-we-not
This research into viruses could help us understand pandemics better - or it could cause one.
By Kelsey Piper Feb 17, 2019, 11:00am EST
The bird flu is a deadly virus with the potential to spark a global pandemic.
Now, thanks to the US government, two lab experiments trying to find ways to make it more dangerous will resume their work after years on hold.
It’s a troubling development, and one that highlights the risks of something called “gain-of-function” research. That’s research in which pathogens are manipulated to change their capabilities — usually to make them deadlier.
Science Magazine last week broke the news that the US had quietly approved the two dangerous and controversial experiments. One of them will begin within the next few weeks. The other is expected to begin later this spring.
The two had been on hold since 2012 amid a fierce debate in the virology community about gain-of-function research. In 2014, the U.S. government declared a moratorium on such research.
That was a bad year on the biohazard front. In June 2014, as many as 75 scientists at the Center for Disease Control and Prevention were exposed to anthrax. A few weeks later, Food and Drug Administration officials ran across 16 forgotten vials of smallpox in storage. Meanwhile, the “largest, most severe and most complex” Ebola outbreak in history was raging across West Africa, and the first patient to be diagnosed in the U.S. had just been announced.
It was in that context that scientists and biosecurity experts found themselves embroiled in a debate about “gain of function” research.
The scientists who do this kind of research argue that we can better anticipate deadly diseases by making diseases deadlier in the lab.
But many people at the time and since have become increasingly convinced that the potential research benefits — which look limited — just don’t outweigh the risks of kicking off the next deadly pandemic ourselves.
But in 2017, the government released new guidelines for gain-of-function research, signaling an end to the blanket moratorium. And the news from last week suggests that dangerous projects are proceeding.
Experts in biosecurity are concerned that the field is heading toward a mistake that could kill innocent people. They argue that, to move ahead with research like this, there should be a transparent process with global stakeholders at the table. After all, if anything goes wrong, the mess we’ll face will certainly be a global one.
That’s dead wrong, Esvelt argues. “Based on the information they had, it was the right call.” When you’re just venturing into a new field and you don’t know how deadly your research might be, you should be exceptionally cautious. As you learn more, you might find that not all of that caution was necessary. But it’s much better than pushing ahead recklessly.
Pushing ahead recklessly is what we’re doing today — and the stakes are higher. Some scientists are studying diseases with the potential to become pandemics that could kill millions.
They’re sometimes making these diseases either more dangerous or easier to transmit among animals, in order to better understand how diseases spread. Amid controversies, this research is continuing. And experts argue there isn’t enough transparency about why.
The deadliest influenza strain in history was the 1918 pandemic, which was estimated to have killed 50 million people. H5N1 has killed more than half of people it infects, and while it’d likely become less lethal when modified to be more transmissible, it’s very, very dangerous.
linkovi:
https://www.vox.com/2019/2/17/18225938/biologists-are-trying-to-make-bird-flu-easier-to-spread-can-we-not
Guest- Guest
Re: A možda ipak ...
by michaellcmacha 6/4/2020, 02:50
a možda je onaj što je pobjego iz kaveza i ugrizo onog za lice...Gnječ wrote:michaellcmacha wrote:2012... 6 oboljelih 2 umrla.... pa onda dugo dugo ništa... pa onda rusvaj... ma koga zabole za taj razvojno dinamički slijed...jesmo rekli da čovjek nema ništa s tim jesmo... aj zdravo.... ;)Gnječ wrote:Modern genetic analysis allows pathogens to be precisely identified, and because all circulating pathogens show genetic changes over time, the year that a particular example of a pathogen emerged can generally be determined, given a sufficient database of samples.
If a pathogen appears in nature after not circulating for years or decades, it may be assumed to have escaped from a laboratory where it had been stored inert for many years, accumulating no genetic changes; that is, its natural evolution had been frozen.
mnogo su si dali truda da ušutkaju sve one koji misle da to nije tako nego je virus sklepan u laboratoriju a sad kako je i na koji način pobjegao iz labosa to vjerojatno nećemo nikada saznati možemo jedino špekulirati dok ne nađemo neki dokument negdje sakriven ili da ulovimo Xi Jinpinga i opalimo mu nekoliko tretmana kineske torture navodnjavanja kap po kap dok ne počne pjevat.
postoji još jedna enigma u njihovim obrazloženjima da je virus "skočio" na ljude drito sa šišmiša. to nije moguće jer šišmiši u kasnu jesen i cijelu zimu hiberniraju.
michaellcmacha- Posts : 21325
2015-08-08
Re: A možda ipak ...
by Guest 6/4/2020, 02:58
michaellcmacha wrote:a možda je onaj što je pobjego iz kaveza i ugrizo onog za lice...Gnječ wrote:michaellcmacha wrote:2012... 6 oboljelih 2 umrla.... pa onda dugo dugo ništa... pa onda rusvaj... ma koga zabole za taj razvojno dinamički slijed...jesmo rekli da čovjek nema ništa s tim jesmo... aj zdravo.... ;)Gnječ wrote:Modern genetic analysis allows pathogens to be precisely identified, and because all circulating pathogens show genetic changes over time, the year that a particular example of a pathogen emerged can generally be determined, given a sufficient database of samples.
If a pathogen appears in nature after not circulating for years or decades, it may be assumed to have escaped from a laboratory where it had been stored inert for many years, accumulating no genetic changes; that is, its natural evolution had been frozen.
mnogo su si dali truda da ušutkaju sve one koji misle da to nije tako nego je virus sklepan u laboratoriju a sad kako je i na koji način pobjegao iz labosa to vjerojatno nećemo nikada saznati možemo jedino špekulirati dok ne nađemo neki dokument negdje sakriven ili da ulovimo Xi Jinpinga i opalimo mu nekoliko tretmana kineske torture navodnjavanja kap po kap dok ne počne pjevat.
postoji još jedna enigma u njihovim obrazloženjima da je virus "skočio" na ljude drito sa šišmiša. to nije moguće jer šišmiši u kasnu jesen i cijelu zimu hiberniraju.
možda. znam da je jedna znanstvenica iz Biolaba iz Wuhana nestala. nitko nezna gdje je jednostavno je isparila na stranicama su izbrisali njenu fotografiju bio-profil CV broj telefona, maila sve podatke su izbrisali. neki kažu i špekuliraju da je ona nulti pacijent.
Guest- Guest
Re: A možda ipak ...
by Leviathan2 6/4/2020, 03:04
ja znam da su virusi korisni organizmi kao i bakterije
ako je ovaj umjetnjak onda je to zajeb, no kad pandemija projde taj se nece vise pojavit ma koliko mutirao
me postoji nista u prirodi sto nema svrhu
ako je ovaj umjetnjak onda je to zajeb, no kad pandemija projde taj se nece vise pojavit ma koliko mutirao
me postoji nista u prirodi sto nema svrhu
_________________
Leviathan2-
Posts : 21431
2015-10-04
Lokacija: : Međurečje -
Page 4 of 12 • 1, 2, 3, 4, 5 ... 10, 11, 12
Similar topics» možda europa ipak ima budućnost...
» New York Times: Možda je ipak narušen Iranski zračni prostor
» Berni iskreno Plenkiju koji mu se rugao na selfie sa kupusom:'Mozda sam glup,mozda sam anitalent za politiku ali bolje i to nego privatizacija,Fimi media,Agrokor...'
» Putin mozda zbog geostrategije i svoje politicke karizme mozda nece pasti ali bi mogao zbog - ekonomije
» KAŽETE IPAK JE ON ČETNIK, A VI STE IPAK IDIOTI!
» New York Times: Možda je ipak narušen Iranski zračni prostor
» Berni iskreno Plenkiju koji mu se rugao na selfie sa kupusom:'Mozda sam glup,mozda sam anitalent za politiku ali bolje i to nego privatizacija,Fimi media,Agrokor...'
» Putin mozda zbog geostrategije i svoje politicke karizme mozda nece pasti ali bi mogao zbog - ekonomije
» KAŽETE IPAK JE ON ČETNIK, A VI STE IPAK IDIOTI!
Page 4 of 12
Permissions in this forum:
You cannot reply to topics in this forum